Part:BBa_K091134:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K091134

This part was tested by iGEM 2012 team Tsinghua.

This part can be uesd to sense the signal of C12HSL. There are many kinds of AHL molecules in nature. Their structures are similar and they share almost the same mechanism. Two AHL molecules can bind with two receptors and form a dimer of dimer. This complex can specificly activate the promoter. Different AHL molecules are from different species.

User Reviews

UNIQ344168a6268ccf6c-partinfo-00000000-QINU UNIQ344168a6268ccf6c-partinfo-00000001-QINU This part was tested by iGEM 2012 team Tsinghua.

When we first tested this part, it didn't work at all. Then we sequenced the part and found many problems. The Plax promoter and PlasR sequence are correct but the rest part is totally wrong.

We rebuild and improve this part by ourselves. We change GFP to RFP in this part. This is because that this RFP protein is much more easily to detect than the GFP. You don't need fluorescent microscope. Besides, we change some the sequence error and make it work finally.

Georgia Tech 2012 iGEM Team Review

Methods and Results

Transformation and Selection

psB1AK3[BBa_K091134] was transformed into chemically competent DH5α cells. Transformed cells were plated on LB agar plates containing either ampicillin, kanamycin, or ampicillin and kanamycin. Colonies were observed on the kan plates and the amp plates but never on the amp and kan plates. Characterization was continued using a colony from the LB/kan plate.

Response to Autoinducer

In the presence of N-oxo3 dodecanoyl homoserine lactone at various concentrations alone (100 μM, 10 μM, 1μM, 0.1 μM, 0.01 μM, 1 nm, 0.1 nm) and N-oxo3 dodecanoyl homoserine lactone (same concentrations) + IPTG, DH5α/psB1AK3[BBa_K091134] did not produce a detectable fluorescent signal. However,the data are less than clear as our positive control showed no fluorescence either.

Sequencing

The psB1AK3/BBa_K091134 plasmid was extracted from the transformed cells for sequencing. Standard primers for sequencing/amplifying BioBrick parts were used: VF2 (tgccacctgacgtctaagaa) and VR (attaccgcctttgagtgagc). The sequencing was successful for both primers. EMBOSS Needle was used to align sequencing results to the expected sequence for the part (see attached sequencing data). The sequence from VF2 from bp 331 to 1099 aligned with the expected sequence from bp 1 to 752 with 92.2% identity. However, it was noted that the region from 332 to 404 bp on the VF2 sequence aligned imperfectly with the expected sequence for that region (1 to 75 bp in the expected sequence for the part). This region is supposed to include the sequence for the PLlac 0-1 promoter (R0011) However, a comparison between the expected sequence (aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca) against the VF2 sequence (agttctggcaggtttggccgcgggttctttttggtacacgaaagc) reveals very little identity (43.1%). This leads us to believe that the promoter region (R0011) for LasR expression is missing and that the part will not function as expected. A BLAST search the VF2 sequence suggests the part does contain the LasR coding sequence (C0079). Directly upstream of the LasR coding sequence is the ribosomal binding site (B0034) which appears to be the correct sequence. However, upstream of the ribosomal binding site, the VF2 sequence BLASTs to the P. aeruginosa lasB gene starting at 247 bp. Upstream of lasB appears to be vector sequence. Nowhere in the sequence is the PLlac 0-1 promoter region (R0011). The VR sequence (reverse complement) from 1 to 939bp aligns with the expected sequence from 1059 to 2047bp with 97.7% identity. There appears to be no significantly misaligned region. The VR sequence appears to contain the correct sequences for the LasR+PAI promoter (R0079), the ribosomal binding site (B0032), GFP (E0040), and the transcriptional terminator (B0010 and B0012).

Conclusions

From the sequencing data alone, it appears that beyond the expected PLlac 0-1 promoter region, the part is otherwise constructed as reported. However, the lack of the PLlac 0-1 promoter region means that lasR will not be expressed and there we anticipate that there will be no response (i.e. fluorescence) to the presence of the autoinducer. To fix this part, the lasB and vector coding sequences upstream of lasR would need to be cut out and replaced with PLlac 0-1. This is predicted to restore the desired function to the part.

Sequencing Data

VF2 Complete Sequence

NNNNNNNNNNNNCCNATAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGC
CAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTG
GGCCTTTCTGCGTTTATATACTAGAGGCCCCTCGCTGAGCGCGTCCCGGAGCTGGGGGCAACCTAGCTGCCACCTGCTTTTCTGCTAGCTATTCCAGCGAAAACATACAG
ATTTCCGGCGAAATCAAGGCTACCTGCCAGTTCTGGCAGGTTTGGCCGCGGGTTCTTTTTGGTACACGAAAGCTACTAGAGAAAGAGGAGAAATACTAGATGGCCTTGGT
TGACGGTTTTCTTGAGCTGGAACGCTCAAGTGGAAAATTGGAGTGGAGCGCCATCCTCCAGAAGATGGCGAGCGACCTTGGATTCTCGAAGATCCTGTTCGGCCTGTTGC
CTAAGGACAGCCAGGACTACGAGAACGCCTTCATCGTCGGCAACTACCCGGCCGCCTGGCGCGAGCATTACGACCGGGCTGGCTACGCGCGGGTCGACCCGACGGTCAGT
CACTGTACCCAGAGCGTACTGCCGATTTTCTGGGAACCGTCCATCTACCAGACGCGAAAGCAGCACGAGTTCTTCGAGGAAGCCTCGGCCGCCGGCCTGGTGTATGGGCT
GACCATGCCGCTGCATGGTGCTCGCGGCGAACTCGGCGCGCTGAGCCTCAGCGTGGAAGCGGAAAACCGGGCCGAGGCCAACCGTTTCATAGAGTCGGTCCTGCCGACCC
TGTGGATGCTCAAGGACTACGCACTGCAAAGCGGTGCCGGACTGGCCTTCGAACATCCGGTCAGCAAACCGGTGGTTCTGACCAGCCGGGANAAGGAAGTGTTGCAGTGG
NGCGCCATCGGCAGACCAGTTGGGAGANATCGGTTATCTGCAACTGCTCGGAAGCCAATGTGAACTTCCATATGGGAAATANTNNNNGGAAGTTCGGNGTGACNNCNNN

VR Complete Sequence (Reverse Complement)

NNNTACCTNCCAGTTCNGGCAGGNTTNGNCCNNGNGTTNTTTTTGGTNCNNGAAAGCTACTAGAGTCACNCAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCAC
TGGAGTNGTCCCAATTNTGTTGAATTAGATGGTGATNNAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTT
ATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTT
TTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTG
TTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAA
CAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGT
CCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTA
CACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGT
GAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACC
CTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGNTCGGTCGTNNNNNNNNNNNNNNNNNNN